ExiProgen™ Protein Expression Optimization Kit

ExiProgen™ Protein Expression Optimization Kit is used for generating linear template DNA that contains six different types of tag sequences. The template DNA made from this kit can be used for cell-free protein synthesis.

$640.00

Cat. No.

K-7410

Product Overview

Solution for Successful Cell-Free Protein Synthesis

Overview

This product can be used to generate template DNA with sequences that can synthesize various tags for screening and maximizing the target protein expression. This allows expressing proteins with template DNA samples that were once difficult to express using ExiProgen™ protein synthesis system. Furthermore, each of the template DNA contains TEV cleavage sites, allowing removal of tags after the protein synthesis if needed.

Features and Benefits

Convenient

Contains all the components essential for generating maximum of 30 different types of template DNA. (However, you must order the 1st primer set for 1st PCR of target gene separately.)
Rapid
Saves time by skipping the cloning step by getting the template DNA through PCR.
Minimized PCR error
Provides AccuPower^® ProFi Taq PCR PreMix, having high accuracy and precision, to lower the error rate as much as possible

Technical/Specs

▶ Procedure

(A) 1^st PCR primer design

1^st Forward primer	GAGCTCGAAAACTTATATTTTCAGGGC + 21 mer from the target gene's 5' end.
1^st Reverse primer	GGGCTTTGTTAGCAGCCGGTCGACCTA + 21 mer from the target gene's 3' gene in reverse complimentary sequence.

E.g.) Control DNA, control primer sets

(B) Template DNA synthesis

Template DNA is synthesized with two PCR steps.

1) 1^st PCR: Amplify the gene of the target protein by using the extended primer (may be ordered with our customized service) containing parts of cassettes.

2) 2^nd PCR: Produce the template DNA with an overlapping PCR by using the 1^st PCR products and the cassette that you wish to use.

▶ Experimental Data

1) Control DNA (18 kDa)

Figure1. Template DNA construction and protein synthesis data for the control DNA.
Each linear template DNA was generated by using ExiProgen™ Protein Expression Optimization Kit.
The linear template DNA was used as templates for protein synthesis with our various protein synthesis kits. Length of the control DNA is 462 bp and molecular weight of the control protein is 18 kDa.

Data (A): 2nd PCR product using the 1% agarose gel image.
Data (B), (C), (D): Each protein was synthesized using 1 µg of DNA and 22.5 µL of the purified protein was loaded on 12% SDS-PAGE gel.
Lane N: No tagged samples
Lane 1-6: tag 1-6 inserted samples.

2) Synthesis of difficult-to-express proteins

Figure2. Protein synthesis data of various sizes of difficult-to-express proteins.
Difficult-to-express proteins were synthesized using the template DNAs generated by the tag screening kit and ExiProgen™ EC Protein Synthesis Kit.

Data (A-F): Synthesized proteins analyzed by SDS-PAGE.
Lane N: No tagged samples
Lane 1-6: tag 1-6 inserted samples.

Literature/Support

◈ Quality Assurance

Bioneer is the holder of Quality Management System Certificates for the following standards.

• ISO 9001 – certificate

References

▶ List of theses using Bioneer ExiProgen™

Issue year	Title of Thesis	Author	Thesis information
2018	Highly efficient genome editing by CRISPR-Cpf1 using CRISPR RNA with a uridinylate-rich 3′-overhang	Bin Moon S, Lee JM, Kang JG, Lee NE, Ha DI, Kim DY, Kim SH, Yoo K, Kim D, Ko JH, Kim YS	Nat Commun. 2018 Sep 7;9(1):3651.
2018	Receptor-mediated dimerization of JAK2 FERM domains is required for JAK2 activation.	Ryan D Ferrao, Heidi JA Wallweber, Patrick J Lupardus	*Elife.* 2018 Jul 25;7.
2018	Selectively Modulating Conformational States of USP7 Catalytic Domain for Activation.	Özen A, Rougé L, Bashore C, Hearn BR, Skelton NJ, Dueber EC	*Structure.* 2018 Jan 2;26(1):72-84.
2016	The OsCYP19-4 Gene Is Expressed as Multiple Alternatively Spliced Transcripts Encoding Isoforms with Distinct Cellular Localizations and PPIase Activities under Cold Stress.	Lee A, Lee SS, Jung WY, Park HJ, Lim BR6 Kim HS, Ahn JC, Cho HS	*Int J Mol Sci.* 2016 Jul 19;17(7).
2016	The role of MscL amphipathic N terminus indicates a blueprint for bilayer-mediated gating of mechanosensitive channels.	Bavi N, Cortes DM, Cox CD, Rohde PR, Liu W, Deitmer JW, Bavi O, Strop P, Hill AP, Rees D, Corry B, Perozo E, Martinac B	*Nat Commun.* 2016 Jun 22;7:11984.
2016	Removal of the mechanoprotective influence of the cytoskeleton reveals PIEZO1 is gated by bilayer tension.	Cox CD, Bae C, Ziegler L, Hartley S, Nikolova-Krstevski V, Rohde PR, Ng CA, Sachs F, Gottlieb PA, Martinac B	*Nat Commun.* 2016 Jan 20;7:10366.
2016	Overexpression of OsCYP19-4 increases tolerance to cold stress and enhances grain yield in rice (Oryza sativa L.)	Yoon DH, Lee SS, Park HJ, Lyu JI, Chong WS, Liu JR, Kim BG, Ahn JC, Cho HS	*J Exp Bot.* 2016 Jan;67(1):69-82.
2015	Development of a Recombinant Protein Vaccine Based on Cell-Free Protein Synthesis for Sevenband Grouper Epinephelus septemfasciatus Against Viral Nervous Necrosis.	Kim JO, Kim JO, Kim WS, Oh MJ	*J Microbiol Biotechnol.* 2015 Oct;25(10):1761-7.

Ordering Info

Cat. No.	Product Description
K-7410	ExiProgen™ Protein Expression Optimization Kit

FAQ

How long the gene should be to synthesize the template DNA?

The size of the target gene should be less than or equal to 1.5 kb.

How are the PCR products purified?

For the 1^st PCR, use gel purification to find the correct PCR product with the same size as the target product.
For the 2^nd PCR, use PCR purification to collect the templates for synthesizing the final protein product.

How can the templates used to make proteins?

ExiProgen™ EC Protein Synthesis Kit can be used to synthesis the proteins with fully automated steps.
AccuRapid™ Protein Synthesis Kit also can be used to synthesis manually.
To use with protein synthesis kit, the acceptable purity of the template has A260/A280 ratio higher than or equal to 1.7 and normally 1 µg/rxn of templates are used.
However, optimizing the usage of reactants and their codons based on E. coli can increase the amount of expressed proteins.

Can I remove the tags from the synthesized proteins?

The template DNA made with this kit contains a TEV protease cleavage site between the gene of interest and the tag sequences. You may use TEV proteases to obtain the protein with tag removed.
The tag removed protein can be simply acquired using ExiProgen™ EC-Tagfree Protein Synthesis Kit that is for synthesizing a protein and removing the tag automatically.

How many kinds of template DNA generated from this kit?

This kit is for producing 30 kinds of template DNA that are five types of the target genes with the tag 1 to 6.
You may make 36 kinds of the template DNA from 6 different genes, instead of the positive control.

If you need any further assistance, please contact sales@bioneer.com.

Selection Guide

The BIONEER products for recombinant protein synthesis and purification are categorized as the following, Those can be selected according to the purpose.

To apply for the ExiProgen™ demo, plase contact sales@bioneer.co.kr .

Process

Product type

Equipment used

Service

DNA Template

Preparation